Review



anti firefly luciferase antibody  (Novus Biologicals)


Bioz Verified Symbol Novus Biologicals is a verified supplier
Bioz Manufacturer Symbol Novus Biologicals manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    Novus Biologicals anti firefly luciferase antibody
    A , Experimental outline. WND238 melanoma cells were transduced with the MeRLin lentiviral barcode library containing semi-random barcodes (BC) embedded within EF1α-driven <t>luciferase</t> and mNeptune2.5 transcripts. Barcoded cells were expanded in vitro and injected subcutaneously into NSG mice to establish tumors. Tumor growth and dissemination were monitored for 4 to 12 weeks. Primary tumors and metastatic lesions, including those from lung and liver, were excised for downstream analyses, including single-cell RNA sequencing (scRNA-seq), bulk RNA sequencing (RNA-seq), and RNA fluorescence in situ hybridization (RNA-FISH). B , In vivo growth curves of barcoded WND238 tumors (n = 3). C , Bioluminescence imaging (BLI) of a mouse bearing a barcoded WND238 tumor 83 days post injection. Signals are detected at the primary site in dorsal (left) and ventral (middle) views. After shielding the primary tumor with a light proof cover, residual signals are detected in the lungs (right). D , Ex vivo BLI of the excised primary tumor (Tu) and organs including lung (Lu), liver (Lv), spleen (Sp), brain (Br), and heart (He), imaged with (left) and without (right) the primary tumor. E , Hematoxylin and eosin (H&E) staining of sections from the primary tumor (left), lung (middle), and liver (right) of the second mouse (scale bar 200 μm). F , Immunohistochemical (IHC) staining for <t>firefly</t> <t>luciferase</t> in sections from the primary tumor (left), lung (middle), and liver (right) of the second mouse (scale bar 200 μm). G , Pie chart showing the clonal composition of the original control (Table S3, bulk RNA-seq). H , Pie charts indicating the hierarchical clonal composition of the primary tumor, lung ( I ), and liver ( J ) (Table S3, scRNA-seq). K , Bubble plot showing the clonal frequency of 14 barcodes shared across all primary and metastatic sites in three biological replicates (ms 291, ms 292, and ms 287).
    Anti Firefly Luciferase Antibody, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 93/100, based on 19 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti firefly luciferase antibody/product/Novus Biologicals
    Average 93 stars, based on 19 article reviews
    anti firefly luciferase antibody - by Bioz Stars, 2026-06
    93/100 stars

    Images

    1) Product Images from "Single-cell lineage tracing maps clonal and transcriptional dynamics in melanoma metastasis"

    Article Title: Single-cell lineage tracing maps clonal and transcriptional dynamics in melanoma metastasis

    Journal: bioRxiv

    doi: 10.64898/2026.04.09.717571

    A , Experimental outline. WND238 melanoma cells were transduced with the MeRLin lentiviral barcode library containing semi-random barcodes (BC) embedded within EF1α-driven luciferase and mNeptune2.5 transcripts. Barcoded cells were expanded in vitro and injected subcutaneously into NSG mice to establish tumors. Tumor growth and dissemination were monitored for 4 to 12 weeks. Primary tumors and metastatic lesions, including those from lung and liver, were excised for downstream analyses, including single-cell RNA sequencing (scRNA-seq), bulk RNA sequencing (RNA-seq), and RNA fluorescence in situ hybridization (RNA-FISH). B , In vivo growth curves of barcoded WND238 tumors (n = 3). C , Bioluminescence imaging (BLI) of a mouse bearing a barcoded WND238 tumor 83 days post injection. Signals are detected at the primary site in dorsal (left) and ventral (middle) views. After shielding the primary tumor with a light proof cover, residual signals are detected in the lungs (right). D , Ex vivo BLI of the excised primary tumor (Tu) and organs including lung (Lu), liver (Lv), spleen (Sp), brain (Br), and heart (He), imaged with (left) and without (right) the primary tumor. E , Hematoxylin and eosin (H&E) staining of sections from the primary tumor (left), lung (middle), and liver (right) of the second mouse (scale bar 200 μm). F , Immunohistochemical (IHC) staining for firefly luciferase in sections from the primary tumor (left), lung (middle), and liver (right) of the second mouse (scale bar 200 μm). G , Pie chart showing the clonal composition of the original control (Table S3, bulk RNA-seq). H , Pie charts indicating the hierarchical clonal composition of the primary tumor, lung ( I ), and liver ( J ) (Table S3, scRNA-seq). K , Bubble plot showing the clonal frequency of 14 barcodes shared across all primary and metastatic sites in three biological replicates (ms 291, ms 292, and ms 287).
    Figure Legend Snippet: A , Experimental outline. WND238 melanoma cells were transduced with the MeRLin lentiviral barcode library containing semi-random barcodes (BC) embedded within EF1α-driven luciferase and mNeptune2.5 transcripts. Barcoded cells were expanded in vitro and injected subcutaneously into NSG mice to establish tumors. Tumor growth and dissemination were monitored for 4 to 12 weeks. Primary tumors and metastatic lesions, including those from lung and liver, were excised for downstream analyses, including single-cell RNA sequencing (scRNA-seq), bulk RNA sequencing (RNA-seq), and RNA fluorescence in situ hybridization (RNA-FISH). B , In vivo growth curves of barcoded WND238 tumors (n = 3). C , Bioluminescence imaging (BLI) of a mouse bearing a barcoded WND238 tumor 83 days post injection. Signals are detected at the primary site in dorsal (left) and ventral (middle) views. After shielding the primary tumor with a light proof cover, residual signals are detected in the lungs (right). D , Ex vivo BLI of the excised primary tumor (Tu) and organs including lung (Lu), liver (Lv), spleen (Sp), brain (Br), and heart (He), imaged with (left) and without (right) the primary tumor. E , Hematoxylin and eosin (H&E) staining of sections from the primary tumor (left), lung (middle), and liver (right) of the second mouse (scale bar 200 μm). F , Immunohistochemical (IHC) staining for firefly luciferase in sections from the primary tumor (left), lung (middle), and liver (right) of the second mouse (scale bar 200 μm). G , Pie chart showing the clonal composition of the original control (Table S3, bulk RNA-seq). H , Pie charts indicating the hierarchical clonal composition of the primary tumor, lung ( I ), and liver ( J ) (Table S3, scRNA-seq). K , Bubble plot showing the clonal frequency of 14 barcodes shared across all primary and metastatic sites in three biological replicates (ms 291, ms 292, and ms 287).

    Techniques Used: Transduction, Luciferase, In Vitro, Injection, Single Cell, RNA Sequencing, Fluorescence, In Situ Hybridization, In Vivo, Imaging, Ex Vivo, Staining, Immunohistochemical staining, Immunohistochemistry, Control



    Similar Products

    renillafirefly dual luciferase assay kit  (MedChemExpress)
    95
    MedChemExpress renillafirefly dual luciferase assay kit
    Renillafirefly Dual Luciferase Assay Kit, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/renillafirefly dual luciferase assay kit/product/MedChemExpress
    Average 95 stars, based on 1 article reviews
    renillafirefly dual luciferase assay kit - by Bioz Stars, 2026-06
    95/100 stars
    		  Buy from Supplier
    rabbit anti fluc luciferase polyclonal antibody  (Bioss)
    94
    Bioss rabbit anti fluc luciferase polyclonal antibody
    Construction and transcriptional analysis of the PRRSV replicon. A , schematic diagram of reporter replicon genome structure, replication, and sg mRNA production. ORF2-6 in the wild-type viral genome were deleted and replaced with the <t>Fluc-T2A-RFP</t> gene cassette. B , gel electrophoresis, restriction enzyme digestion (NotI and AscI), and sequencing analysis of Rep-PRRSV and Rep-ΔORF1b replicon plasmids. C , replication kinetics of Rep-PRRSV. BHK-21 cells were co-transfected with pRL-TK (250 ng) and Rep-PRRSV (2.5 μg), harvested at different time points, and firefly <t>luciferase</t> activity was measured and normalized to Renilla luciferase reading. D , RT-qPCR analysis of sg mRNA levels for Fluc, N, and ORF1ab in BHK-21 cells transfected with Rep-PRRSV, normalized to β-actin gene expression. E , Rep-PRRSV-transfected BHK-21 cells were analyzed at 36 h post-transfection (hpt) by confocal microscopy. Fluc was detected using an anti-Fluc mAb and goat-anti-mouse IgG conjugated with Alexa Fluor 488. Nuclei were stained with Hoechst. F , electron microscopy analysis of double-membrane vesicle structures induced by Rep-PRRSV transfection at 24 hpt. Two-way ANOVA was used to determine statistical significance. ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05; ns, not significant.
    Rabbit Anti Fluc Luciferase Polyclonal Antibody, supplied by Bioss, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rabbit anti fluc luciferase polyclonal antibody/product/Bioss
    Average 94 stars, based on 1 article reviews
    rabbit anti fluc luciferase polyclonal antibody - by Bioz Stars, 2026-06
    94/100 stars
    		  Buy from Supplier
    anti firefly luciferase antibody  (Novus Biologicals)
    93
    Novus Biologicals anti firefly luciferase antibody
    A , Experimental outline. WND238 melanoma cells were transduced with the MeRLin lentiviral barcode library containing semi-random barcodes (BC) embedded within EF1α-driven <t>luciferase</t> and mNeptune2.5 transcripts. Barcoded cells were expanded in vitro and injected subcutaneously into NSG mice to establish tumors. Tumor growth and dissemination were monitored for 4 to 12 weeks. Primary tumors and metastatic lesions, including those from lung and liver, were excised for downstream analyses, including single-cell RNA sequencing (scRNA-seq), bulk RNA sequencing (RNA-seq), and RNA fluorescence in situ hybridization (RNA-FISH). B , In vivo growth curves of barcoded WND238 tumors (n = 3). C , Bioluminescence imaging (BLI) of a mouse bearing a barcoded WND238 tumor 83 days post injection. Signals are detected at the primary site in dorsal (left) and ventral (middle) views. After shielding the primary tumor with a light proof cover, residual signals are detected in the lungs (right). D , Ex vivo BLI of the excised primary tumor (Tu) and organs including lung (Lu), liver (Lv), spleen (Sp), brain (Br), and heart (He), imaged with (left) and without (right) the primary tumor. E , Hematoxylin and eosin (H&E) staining of sections from the primary tumor (left), lung (middle), and liver (right) of the second mouse (scale bar 200 μm). F , Immunohistochemical (IHC) staining for <t>firefly</t> <t>luciferase</t> in sections from the primary tumor (left), lung (middle), and liver (right) of the second mouse (scale bar 200 μm). G , Pie chart showing the clonal composition of the original control (Table S3, bulk RNA-seq). H , Pie charts indicating the hierarchical clonal composition of the primary tumor, lung ( I ), and liver ( J ) (Table S3, scRNA-seq). K , Bubble plot showing the clonal frequency of 14 barcodes shared across all primary and metastatic sites in three biological replicates (ms 291, ms 292, and ms 287).
    Anti Firefly Luciferase Antibody, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti firefly luciferase antibody/product/Novus Biologicals
    Average 93 stars, based on 1 article reviews
    anti firefly luciferase antibody - by Bioz Stars, 2026-06
    93/100 stars
    		  Buy from Supplier
    anti firefly luciferase sirna  (Alnylam Inc)
    86
    Alnylam Inc anti firefly luciferase sirna
    A , Experimental outline. WND238 melanoma cells were transduced with the MeRLin lentiviral barcode library containing semi-random barcodes (BC) embedded within EF1α-driven <t>luciferase</t> and mNeptune2.5 transcripts. Barcoded cells were expanded in vitro and injected subcutaneously into NSG mice to establish tumors. Tumor growth and dissemination were monitored for 4 to 12 weeks. Primary tumors and metastatic lesions, including those from lung and liver, were excised for downstream analyses, including single-cell RNA sequencing (scRNA-seq), bulk RNA sequencing (RNA-seq), and RNA fluorescence in situ hybridization (RNA-FISH). B , In vivo growth curves of barcoded WND238 tumors (n = 3). C , Bioluminescence imaging (BLI) of a mouse bearing a barcoded WND238 tumor 83 days post injection. Signals are detected at the primary site in dorsal (left) and ventral (middle) views. After shielding the primary tumor with a light proof cover, residual signals are detected in the lungs (right). D , Ex vivo BLI of the excised primary tumor (Tu) and organs including lung (Lu), liver (Lv), spleen (Sp), brain (Br), and heart (He), imaged with (left) and without (right) the primary tumor. E , Hematoxylin and eosin (H&E) staining of sections from the primary tumor (left), lung (middle), and liver (right) of the second mouse (scale bar 200 μm). F , Immunohistochemical (IHC) staining for <t>firefly</t> <t>luciferase</t> in sections from the primary tumor (left), lung (middle), and liver (right) of the second mouse (scale bar 200 μm). G , Pie chart showing the clonal composition of the original control (Table S3, bulk RNA-seq). H , Pie charts indicating the hierarchical clonal composition of the primary tumor, lung ( I ), and liver ( J ) (Table S3, scRNA-seq). K , Bubble plot showing the clonal frequency of 14 barcodes shared across all primary and metastatic sites in three biological replicates (ms 291, ms 292, and ms 287).
    Anti Firefly Luciferase Sirna, supplied by Alnylam Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti firefly luciferase sirna/product/Alnylam Inc
    Average 86 stars, based on 1 article reviews
    anti firefly luciferase sirna - by Bioz Stars, 2026-06
    86/100 stars
    		  Buy from Supplier
    anti firefly luciferase  (Cell Signaling Technology Inc)
    86
    Cell Signaling Technology Inc anti firefly luciferase
    A , Experimental outline. WND238 melanoma cells were transduced with the MeRLin lentiviral barcode library containing semi-random barcodes (BC) embedded within EF1α-driven <t>luciferase</t> and mNeptune2.5 transcripts. Barcoded cells were expanded in vitro and injected subcutaneously into NSG mice to establish tumors. Tumor growth and dissemination were monitored for 4 to 12 weeks. Primary tumors and metastatic lesions, including those from lung and liver, were excised for downstream analyses, including single-cell RNA sequencing (scRNA-seq), bulk RNA sequencing (RNA-seq), and RNA fluorescence in situ hybridization (RNA-FISH). B , In vivo growth curves of barcoded WND238 tumors (n = 3). C , Bioluminescence imaging (BLI) of a mouse bearing a barcoded WND238 tumor 83 days post injection. Signals are detected at the primary site in dorsal (left) and ventral (middle) views. After shielding the primary tumor with a light proof cover, residual signals are detected in the lungs (right). D , Ex vivo BLI of the excised primary tumor (Tu) and organs including lung (Lu), liver (Lv), spleen (Sp), brain (Br), and heart (He), imaged with (left) and without (right) the primary tumor. E , Hematoxylin and eosin (H&E) staining of sections from the primary tumor (left), lung (middle), and liver (right) of the second mouse (scale bar 200 μm). F , Immunohistochemical (IHC) staining for <t>firefly</t> <t>luciferase</t> in sections from the primary tumor (left), lung (middle), and liver (right) of the second mouse (scale bar 200 μm). G , Pie chart showing the clonal composition of the original control (Table S3, bulk RNA-seq). H , Pie charts indicating the hierarchical clonal composition of the primary tumor, lung ( I ), and liver ( J ) (Table S3, scRNA-seq). K , Bubble plot showing the clonal frequency of 14 barcodes shared across all primary and metastatic sites in three biological replicates (ms 291, ms 292, and ms 287).
    Anti Firefly Luciferase, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti firefly luciferase/product/Cell Signaling Technology Inc
    Average 86 stars, based on 1 article reviews
    anti firefly luciferase - by Bioz Stars, 2026-06
    86/100 stars
    		  Buy from Supplier
    plx304 luciferase v5 blast  (MedChemExpress)
    95
    MedChemExpress plx304 luciferase v5 blast
    A , Experimental outline. WND238 melanoma cells were transduced with the MeRLin lentiviral barcode library containing semi-random barcodes (BC) embedded within EF1α-driven <t>luciferase</t> and mNeptune2.5 transcripts. Barcoded cells were expanded in vitro and injected subcutaneously into NSG mice to establish tumors. Tumor growth and dissemination were monitored for 4 to 12 weeks. Primary tumors and metastatic lesions, including those from lung and liver, were excised for downstream analyses, including single-cell RNA sequencing (scRNA-seq), bulk RNA sequencing (RNA-seq), and RNA fluorescence in situ hybridization (RNA-FISH). B , In vivo growth curves of barcoded WND238 tumors (n = 3). C , Bioluminescence imaging (BLI) of a mouse bearing a barcoded WND238 tumor 83 days post injection. Signals are detected at the primary site in dorsal (left) and ventral (middle) views. After shielding the primary tumor with a light proof cover, residual signals are detected in the lungs (right). D , Ex vivo BLI of the excised primary tumor (Tu) and organs including lung (Lu), liver (Lv), spleen (Sp), brain (Br), and heart (He), imaged with (left) and without (right) the primary tumor. E , Hematoxylin and eosin (H&E) staining of sections from the primary tumor (left), lung (middle), and liver (right) of the second mouse (scale bar 200 μm). F , Immunohistochemical (IHC) staining for <t>firefly</t> <t>luciferase</t> in sections from the primary tumor (left), lung (middle), and liver (right) of the second mouse (scale bar 200 μm). G , Pie chart showing the clonal composition of the original control (Table S3, bulk RNA-seq). H , Pie charts indicating the hierarchical clonal composition of the primary tumor, lung ( I ), and liver ( J ) (Table S3, scRNA-seq). K , Bubble plot showing the clonal frequency of 14 barcodes shared across all primary and metastatic sites in three biological replicates (ms 291, ms 292, and ms 287).
    Plx304 Luciferase V5 Blast, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plx304 luciferase v5 blast/product/MedChemExpress
    Average 95 stars, based on 1 article reviews
    plx304 luciferase v5 blast - by Bioz Stars, 2026-06
    95/100 stars
    		  Buy from Supplier
    rabbit anti fluc luciferase polyclonal antibody 367  (Bioss)
    94
    Bioss rabbit anti fluc luciferase polyclonal antibody 367
    A , Experimental outline. WND238 melanoma cells were transduced with the MeRLin lentiviral barcode library containing semi-random barcodes (BC) embedded within EF1α-driven <t>luciferase</t> and mNeptune2.5 transcripts. Barcoded cells were expanded in vitro and injected subcutaneously into NSG mice to establish tumors. Tumor growth and dissemination were monitored for 4 to 12 weeks. Primary tumors and metastatic lesions, including those from lung and liver, were excised for downstream analyses, including single-cell RNA sequencing (scRNA-seq), bulk RNA sequencing (RNA-seq), and RNA fluorescence in situ hybridization (RNA-FISH). B , In vivo growth curves of barcoded WND238 tumors (n = 3). C , Bioluminescence imaging (BLI) of a mouse bearing a barcoded WND238 tumor 83 days post injection. Signals are detected at the primary site in dorsal (left) and ventral (middle) views. After shielding the primary tumor with a light proof cover, residual signals are detected in the lungs (right). D , Ex vivo BLI of the excised primary tumor (Tu) and organs including lung (Lu), liver (Lv), spleen (Sp), brain (Br), and heart (He), imaged with (left) and without (right) the primary tumor. E , Hematoxylin and eosin (H&E) staining of sections from the primary tumor (left), lung (middle), and liver (right) of the second mouse (scale bar 200 μm). F , Immunohistochemical (IHC) staining for <t>firefly</t> <t>luciferase</t> in sections from the primary tumor (left), lung (middle), and liver (right) of the second mouse (scale bar 200 μm). G , Pie chart showing the clonal composition of the original control (Table S3, bulk RNA-seq). H , Pie charts indicating the hierarchical clonal composition of the primary tumor, lung ( I ), and liver ( J ) (Table S3, scRNA-seq). K , Bubble plot showing the clonal frequency of 14 barcodes shared across all primary and metastatic sites in three biological replicates (ms 291, ms 292, and ms 287).
    Rabbit Anti Fluc Luciferase Polyclonal Antibody 367, supplied by Bioss, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rabbit anti fluc luciferase polyclonal antibody 367/product/Bioss
    Average 94 stars, based on 1 article reviews
    rabbit anti fluc luciferase polyclonal antibody 367 - by Bioz Stars, 2026-06
    94/100 stars
    		  Buy from Supplier
    anti-fluc antibody  (Thermo Fisher)
    90
    Thermo Fisher anti-fluc antibody
    A , Experimental outline. WND238 melanoma cells were transduced with the MeRLin lentiviral barcode library containing semi-random barcodes (BC) embedded within EF1α-driven <t>luciferase</t> and mNeptune2.5 transcripts. Barcoded cells were expanded in vitro and injected subcutaneously into NSG mice to establish tumors. Tumor growth and dissemination were monitored for 4 to 12 weeks. Primary tumors and metastatic lesions, including those from lung and liver, were excised for downstream analyses, including single-cell RNA sequencing (scRNA-seq), bulk RNA sequencing (RNA-seq), and RNA fluorescence in situ hybridization (RNA-FISH). B , In vivo growth curves of barcoded WND238 tumors (n = 3). C , Bioluminescence imaging (BLI) of a mouse bearing a barcoded WND238 tumor 83 days post injection. Signals are detected at the primary site in dorsal (left) and ventral (middle) views. After shielding the primary tumor with a light proof cover, residual signals are detected in the lungs (right). D , Ex vivo BLI of the excised primary tumor (Tu) and organs including lung (Lu), liver (Lv), spleen (Sp), brain (Br), and heart (He), imaged with (left) and without (right) the primary tumor. E , Hematoxylin and eosin (H&E) staining of sections from the primary tumor (left), lung (middle), and liver (right) of the second mouse (scale bar 200 μm). F , Immunohistochemical (IHC) staining for <t>firefly</t> <t>luciferase</t> in sections from the primary tumor (left), lung (middle), and liver (right) of the second mouse (scale bar 200 μm). G , Pie chart showing the clonal composition of the original control (Table S3, bulk RNA-seq). H , Pie charts indicating the hierarchical clonal composition of the primary tumor, lung ( I ), and liver ( J ) (Table S3, scRNA-seq). K , Bubble plot showing the clonal frequency of 14 barcodes shared across all primary and metastatic sites in three biological replicates (ms 291, ms 292, and ms 287).
    Anti Fluc Antibody, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti-fluc antibody/product/Thermo Fisher
    Average 90 stars, based on 1 article reviews
    anti-fluc antibody - by Bioz Stars, 2026-06
    90/100 stars
    		  Buy from Supplier
    antibody against firefly luciferase  (Santa Cruz Biotechnology)
    93
    Santa Cruz Biotechnology antibody against firefly luciferase
    Comparison of the top performing WG‐PL14 LNPs with MC3 LNPs for intra‐articular injections. A) Representative biodistribution image of <t>luciferase</t> expression for original and optimized formulation LNP. B) The biodistribution image of luciferase expression in articular cartilage as measured with an IVIS imaging system 24 h after intra‐articular injection of 2 µg of total mRNA. C) Immunofluorescence staining for Luc in mouse chondrocytes after intra‐articular injection of LNP‐Luc mRNA (2 µg mRNA). The yellow arrows indicate the luminescent zone. D) Representative TEM and STEM of LNPs. E) The biodistribution image of luciferase expression in articular cartilage after intra‐articular injection of concentrated and unconcentrated LNP‐Luc mRNA (2 µg mRNA). F) The comparison between WG‐PL14 and MC3 in vivo expression, after injection of LNP‐Luc mRNA (2 µg mRNA), then imaged in 6, 24, 48, 72, and 96 h. Data were represented as mean ± SEM. Statistical significance was calculated by t ‐test. The unit of the fluorescent scale bar is photons/sec/cm 2 /sr, the F radiance scale of 1.0 × 10 7 –2 × 10 8 ( * p < 0.05, ** p < 0.01, and *** p < 0.001).
    Antibody Against Firefly Luciferase, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/antibody against firefly luciferase/product/Santa Cruz Biotechnology
    Average 93 stars, based on 1 article reviews
    antibody against firefly luciferase - by Bioz Stars, 2026-06
    93/100 stars
    		  Buy from Supplier

    Image Search Results


    Construction and transcriptional analysis of the PRRSV replicon. A , schematic diagram of reporter replicon genome structure, replication, and sg mRNA production. ORF2-6 in the wild-type viral genome were deleted and replaced with the Fluc-T2A-RFP gene cassette. B , gel electrophoresis, restriction enzyme digestion (NotI and AscI), and sequencing analysis of Rep-PRRSV and Rep-ΔORF1b replicon plasmids. C , replication kinetics of Rep-PRRSV. BHK-21 cells were co-transfected with pRL-TK (250 ng) and Rep-PRRSV (2.5 μg), harvested at different time points, and firefly luciferase activity was measured and normalized to Renilla luciferase reading. D , RT-qPCR analysis of sg mRNA levels for Fluc, N, and ORF1ab in BHK-21 cells transfected with Rep-PRRSV, normalized to β-actin gene expression. E , Rep-PRRSV-transfected BHK-21 cells were analyzed at 36 h post-transfection (hpt) by confocal microscopy. Fluc was detected using an anti-Fluc mAb and goat-anti-mouse IgG conjugated with Alexa Fluor 488. Nuclei were stained with Hoechst. F , electron microscopy analysis of double-membrane vesicle structures induced by Rep-PRRSV transfection at 24 hpt. Two-way ANOVA was used to determine statistical significance. ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05; ns, not significant.

    Journal: The Journal of Biological Chemistry

    Article Title: Key amino acids in RNA polymerase and helicase proteins regulate RNA synthesis efficiency in porcine reproductive and respiratory syndrome virus

    doi: 10.1016/j.jbc.2025.110247

    Figure Lengend Snippet: Construction and transcriptional analysis of the PRRSV replicon. A , schematic diagram of reporter replicon genome structure, replication, and sg mRNA production. ORF2-6 in the wild-type viral genome were deleted and replaced with the Fluc-T2A-RFP gene cassette. B , gel electrophoresis, restriction enzyme digestion (NotI and AscI), and sequencing analysis of Rep-PRRSV and Rep-ΔORF1b replicon plasmids. C , replication kinetics of Rep-PRRSV. BHK-21 cells were co-transfected with pRL-TK (250 ng) and Rep-PRRSV (2.5 μg), harvested at different time points, and firefly luciferase activity was measured and normalized to Renilla luciferase reading. D , RT-qPCR analysis of sg mRNA levels for Fluc, N, and ORF1ab in BHK-21 cells transfected with Rep-PRRSV, normalized to β-actin gene expression. E , Rep-PRRSV-transfected BHK-21 cells were analyzed at 36 h post-transfection (hpt) by confocal microscopy. Fluc was detected using an anti-Fluc mAb and goat-anti-mouse IgG conjugated with Alexa Fluor 488. Nuclei were stained with Hoechst. F , electron microscopy analysis of double-membrane vesicle structures induced by Rep-PRRSV transfection at 24 hpt. Two-way ANOVA was used to determine statistical significance. ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05; ns, not significant.

    Article Snippet: The primary antibodies used in this study were: rabbit anti-PRRSV-N polyclonal antibody (generated in our laboratory), rabbit anti-Fluc luciferase polyclonal antibody (BIOSS, bsm-33318M), mouse anti-β-Actin monoclonal antibody (Tianjin Sungene, DKM9001L), and mouse anti-GAPDH monoclonal antibody (Tianjin Sungene, DKM9002).

    Techniques: Nucleic Acid Electrophoresis, Sequencing, Transfection, Luciferase, Activity Assay, Quantitative RT-PCR, Gene Expression, Confocal Microscopy, Staining, Electron Microscopy, Membrane

    Evaluation of transcriptional regulatory efficiency of TRSs in Rep-PRRSV. A , replicon plasmids containing transcriptional units with different transcription-regulating sequences B (TRSB) (TRS2: ACCCTGTCATTGAACCAACTTTAG, TRS3: AGGGTCAAATGTAACCATAGTGTA, TRS4: AGCAATTGGTTTCACCTGGAATGG, TRS5: AGCAACCGTTTTAGCCTGTCTTTT, TRS6: AGCAACCCTTTAACCAGAGTTTC, TRS7.1: ACGGCAAATGATAACCACGCATTT, TRS7.2: AAGGGAGTGGTAAACCTTGTTAAA) inserted upstream of the Fluc-T2A-RFP reporter were constructed using the Rep-PRRSV backbone. B , Luciferase activity and ( C ) RFP fluorescence intensity was measured at 36 h post-transfection to assess TRS regulatory efficiency. One-way ANOVA was used to determine statistical significance. ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05; ns, not significant.

    Journal: The Journal of Biological Chemistry

    Article Title: Key amino acids in RNA polymerase and helicase proteins regulate RNA synthesis efficiency in porcine reproductive and respiratory syndrome virus

    doi: 10.1016/j.jbc.2025.110247

    Figure Lengend Snippet: Evaluation of transcriptional regulatory efficiency of TRSs in Rep-PRRSV. A , replicon plasmids containing transcriptional units with different transcription-regulating sequences B (TRSB) (TRS2: ACCCTGTCATTGAACCAACTTTAG, TRS3: AGGGTCAAATGTAACCATAGTGTA, TRS4: AGCAATTGGTTTCACCTGGAATGG, TRS5: AGCAACCGTTTTAGCCTGTCTTTT, TRS6: AGCAACCCTTTAACCAGAGTTTC, TRS7.1: ACGGCAAATGATAACCACGCATTT, TRS7.2: AAGGGAGTGGTAAACCTTGTTAAA) inserted upstream of the Fluc-T2A-RFP reporter were constructed using the Rep-PRRSV backbone. B , Luciferase activity and ( C ) RFP fluorescence intensity was measured at 36 h post-transfection to assess TRS regulatory efficiency. One-way ANOVA was used to determine statistical significance. ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05; ns, not significant.

    Article Snippet: The primary antibodies used in this study were: rabbit anti-PRRSV-N polyclonal antibody (generated in our laboratory), rabbit anti-Fluc luciferase polyclonal antibody (BIOSS, bsm-33318M), mouse anti-β-Actin monoclonal antibody (Tianjin Sungene, DKM9001L), and mouse anti-GAPDH monoclonal antibody (Tianjin Sungene, DKM9002).

    Techniques: Construct, Luciferase, Activity Assay, Fluorescence, Transfection

    Regulatory effects of PRRSV non-structural and structural proteins on replicon transcription. A , BHK-21 cells were co-transfected with Rep-PRRSV (1 μg) and plasmids expressing individual PRRSV nsps (0.5 μg), and Fluc activity was measured at 36 hpt to assess their effects on replicon transcription. B , PRRSV nsps protein expression was analyzed by Western blot 36 hpt. C and D , increasing concentrations of nsp9-HA and nsp12-HA plasmids were co-transfected with Rep-PRRSV into BHK-21 cells, and luciferase activity was measured at 36 hpt. E , effect of GP5, M, and N overexpression on Rep-PRRSV transcriptional activity. F , Analysis of nsp9 and nsp12 overexpression effects on rHP-PRRSV/SD16/TRS6-EGFP replication. MARC-145 cells were transfected with nsp9-HA or nsp12-HA plasmids for 24 h, followed by infection with rHP-PRRSV/SD16/TRS6-EGFP (MOI 0.1). Cells were harvested 24 h later, and viral replication was analyzed by Western blot. Data represent the mean ± SD of three independent experiments. ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05; ns, not significant compared to the indicated control samples.

    Journal: The Journal of Biological Chemistry

    Article Title: Key amino acids in RNA polymerase and helicase proteins regulate RNA synthesis efficiency in porcine reproductive and respiratory syndrome virus

    doi: 10.1016/j.jbc.2025.110247

    Figure Lengend Snippet: Regulatory effects of PRRSV non-structural and structural proteins on replicon transcription. A , BHK-21 cells were co-transfected with Rep-PRRSV (1 μg) and plasmids expressing individual PRRSV nsps (0.5 μg), and Fluc activity was measured at 36 hpt to assess their effects on replicon transcription. B , PRRSV nsps protein expression was analyzed by Western blot 36 hpt. C and D , increasing concentrations of nsp9-HA and nsp12-HA plasmids were co-transfected with Rep-PRRSV into BHK-21 cells, and luciferase activity was measured at 36 hpt. E , effect of GP5, M, and N overexpression on Rep-PRRSV transcriptional activity. F , Analysis of nsp9 and nsp12 overexpression effects on rHP-PRRSV/SD16/TRS6-EGFP replication. MARC-145 cells were transfected with nsp9-HA or nsp12-HA plasmids for 24 h, followed by infection with rHP-PRRSV/SD16/TRS6-EGFP (MOI 0.1). Cells were harvested 24 h later, and viral replication was analyzed by Western blot. Data represent the mean ± SD of three independent experiments. ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05; ns, not significant compared to the indicated control samples.

    Article Snippet: The primary antibodies used in this study were: rabbit anti-PRRSV-N polyclonal antibody (generated in our laboratory), rabbit anti-Fluc luciferase polyclonal antibody (BIOSS, bsm-33318M), mouse anti-β-Actin monoclonal antibody (Tianjin Sungene, DKM9001L), and mouse anti-GAPDH monoclonal antibody (Tianjin Sungene, DKM9002).

    Techniques: Transfection, Expressing, Activity Assay, Western Blot, Luciferase, Over Expression, Infection, Control

    Construction and characterization of subgenomic replicon sg-Rep-PRRSV. A , schematic diagram of the sg-Rep-PRRSV subgenomic replicon containing 5′ and 3′UTRs, leader TRS, Fluc reporter, and ORF7. B , construction and sequencing validation of sg-Rep-PRRSV and mini-RTC system plasmids. C , BHK-21 cells were co-transfected with the indicated plasmids, and Fluc activity and protein expression were analyzed by luciferase assay and Western blot at 36 h post-transfection (hpt). D , analysis of sg-Rep-PRRSV-Fluc expression under different ratios of nsp8-9, nsp10, nsp11, and nsp12. E , AlphaFold two was used to model the 3D structure of PRRSV nsp9, showing specific functional regions (NiRAN, fingers, palm, and thumb of RdRp) and the spatial positions of conserved motifs, as visualized using PyMOL. F , activity assessment of nsp9 conserved functional domain mutants using the sg-Rep-PRRSV system. Bars represent mean ± SD. ∗∗∗∗ p < 0.0001; ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05; ns, not significant.

    Journal: The Journal of Biological Chemistry

    Article Title: Key amino acids in RNA polymerase and helicase proteins regulate RNA synthesis efficiency in porcine reproductive and respiratory syndrome virus

    doi: 10.1016/j.jbc.2025.110247

    Figure Lengend Snippet: Construction and characterization of subgenomic replicon sg-Rep-PRRSV. A , schematic diagram of the sg-Rep-PRRSV subgenomic replicon containing 5′ and 3′UTRs, leader TRS, Fluc reporter, and ORF7. B , construction and sequencing validation of sg-Rep-PRRSV and mini-RTC system plasmids. C , BHK-21 cells were co-transfected with the indicated plasmids, and Fluc activity and protein expression were analyzed by luciferase assay and Western blot at 36 h post-transfection (hpt). D , analysis of sg-Rep-PRRSV-Fluc expression under different ratios of nsp8-9, nsp10, nsp11, and nsp12. E , AlphaFold two was used to model the 3D structure of PRRSV nsp9, showing specific functional regions (NiRAN, fingers, palm, and thumb of RdRp) and the spatial positions of conserved motifs, as visualized using PyMOL. F , activity assessment of nsp9 conserved functional domain mutants using the sg-Rep-PRRSV system. Bars represent mean ± SD. ∗∗∗∗ p < 0.0001; ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05; ns, not significant.

    Article Snippet: The primary antibodies used in this study were: rabbit anti-PRRSV-N polyclonal antibody (generated in our laboratory), rabbit anti-Fluc luciferase polyclonal antibody (BIOSS, bsm-33318M), mouse anti-β-Actin monoclonal antibody (Tianjin Sungene, DKM9001L), and mouse anti-GAPDH monoclonal antibody (Tianjin Sungene, DKM9002).

    Techniques: Sequencing, Biomarker Discovery, Transfection, Activity Assay, Expressing, Luciferase, Western Blot, Functional Assay

    Evaluation of the effect of GD- and XM-2020-derived mini-RTC components on sg-Rep-PRRSV(GD) transcription. A , sequence alignment and ( B ) predicted secondary structures of the 5′ and 3′UTRs from PRRSV GD and XM-2020. C , expression of nsps, ( D ) Fluc activity assay, and ( E ) percentage of Fluc-positive cells in BHK-21 cells co-transfected with sg-Rep-PRRSV and mini-RTC components derived from either GD or XM-2020 at 36 hpt. Data represent the mean ± SD of three independent experiments. ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05; ns, not significant.

    Journal: The Journal of Biological Chemistry

    Article Title: Key amino acids in RNA polymerase and helicase proteins regulate RNA synthesis efficiency in porcine reproductive and respiratory syndrome virus

    doi: 10.1016/j.jbc.2025.110247

    Figure Lengend Snippet: Evaluation of the effect of GD- and XM-2020-derived mini-RTC components on sg-Rep-PRRSV(GD) transcription. A , sequence alignment and ( B ) predicted secondary structures of the 5′ and 3′UTRs from PRRSV GD and XM-2020. C , expression of nsps, ( D ) Fluc activity assay, and ( E ) percentage of Fluc-positive cells in BHK-21 cells co-transfected with sg-Rep-PRRSV and mini-RTC components derived from either GD or XM-2020 at 36 hpt. Data represent the mean ± SD of three independent experiments. ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05; ns, not significant.

    Article Snippet: The primary antibodies used in this study were: rabbit anti-PRRSV-N polyclonal antibody (generated in our laboratory), rabbit anti-Fluc luciferase polyclonal antibody (BIOSS, bsm-33318M), mouse anti-β-Actin monoclonal antibody (Tianjin Sungene, DKM9001L), and mouse anti-GAPDH monoclonal antibody (Tianjin Sungene, DKM9002).

    Techniques: Derivative Assay, Sequencing, Expressing, Activity Assay, Transfection

    Effect of nsp9 characteristic mutations on sg-Rep-PRRSV transcription efficiency. A , sequence alignment of nsp9 from PRRSV GD and XM-2020 strains, highlighting amino acid differences. B , AlphaFold 2-predicted 3D structure of nsp9 with selected mutations highlighted in stick representation in PyMOL. C , sequencing results of nsp8-9 expression plasmids carrying single point mutations. D , BHK-21 cells were co-transfected with sg-Rep-PRRSV, nsp9 mutants, and other mini-RTC components (nsp10–12), and Fluc activity was measured at 36 hpt. Data represent the mean ± SD of three independent experiments. ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05; ns, not significant.

    Journal: The Journal of Biological Chemistry

    Article Title: Key amino acids in RNA polymerase and helicase proteins regulate RNA synthesis efficiency in porcine reproductive and respiratory syndrome virus

    doi: 10.1016/j.jbc.2025.110247

    Figure Lengend Snippet: Effect of nsp9 characteristic mutations on sg-Rep-PRRSV transcription efficiency. A , sequence alignment of nsp9 from PRRSV GD and XM-2020 strains, highlighting amino acid differences. B , AlphaFold 2-predicted 3D structure of nsp9 with selected mutations highlighted in stick representation in PyMOL. C , sequencing results of nsp8-9 expression plasmids carrying single point mutations. D , BHK-21 cells were co-transfected with sg-Rep-PRRSV, nsp9 mutants, and other mini-RTC components (nsp10–12), and Fluc activity was measured at 36 hpt. Data represent the mean ± SD of three independent experiments. ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05; ns, not significant.

    Article Snippet: The primary antibodies used in this study were: rabbit anti-PRRSV-N polyclonal antibody (generated in our laboratory), rabbit anti-Fluc luciferase polyclonal antibody (BIOSS, bsm-33318M), mouse anti-β-Actin monoclonal antibody (Tianjin Sungene, DKM9001L), and mouse anti-GAPDH monoclonal antibody (Tianjin Sungene, DKM9002).

    Techniques: Sequencing, Expressing, Transfection, Activity Assay

    Effect of nsp10 characteristic mutations on sg-Rep-PRRSV transcription efficiency. A , sequence alignment of nsp10 from PRRSV GD and XM-2020 strains, highlighting amino acid differences. B , AlphaFold 2-predicted 3D structure of nsp10 with selected mutations highlighted in stick representation in PyMOL. C , sequencing results of nsp10 expression plasmids carrying single point mutations. D , BHK-21 cells were co-transfected with sg-Rep-PRRSV, nsp10 mutants, and other mini-RTC components, and Fluc activity was measured at 36 hpt. Data are presented as mean ± SD, representing three independent experiments. ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05; ns, not significant.

    Journal: The Journal of Biological Chemistry

    Article Title: Key amino acids in RNA polymerase and helicase proteins regulate RNA synthesis efficiency in porcine reproductive and respiratory syndrome virus

    doi: 10.1016/j.jbc.2025.110247

    Figure Lengend Snippet: Effect of nsp10 characteristic mutations on sg-Rep-PRRSV transcription efficiency. A , sequence alignment of nsp10 from PRRSV GD and XM-2020 strains, highlighting amino acid differences. B , AlphaFold 2-predicted 3D structure of nsp10 with selected mutations highlighted in stick representation in PyMOL. C , sequencing results of nsp10 expression plasmids carrying single point mutations. D , BHK-21 cells were co-transfected with sg-Rep-PRRSV, nsp10 mutants, and other mini-RTC components, and Fluc activity was measured at 36 hpt. Data are presented as mean ± SD, representing three independent experiments. ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05; ns, not significant.

    Article Snippet: The primary antibodies used in this study were: rabbit anti-PRRSV-N polyclonal antibody (generated in our laboratory), rabbit anti-Fluc luciferase polyclonal antibody (BIOSS, bsm-33318M), mouse anti-β-Actin monoclonal antibody (Tianjin Sungene, DKM9001L), and mouse anti-GAPDH monoclonal antibody (Tianjin Sungene, DKM9002).

    Techniques: Sequencing, Expressing, Transfection, Activity Assay

    Effect of nsp12 characteristic mutations on sg-Rep-PRRSV transcription efficiency. A , sequence alignment of nsp12 from PRRSV GD and XM-2020 strains, highlighting amino acid differences. B , AlphaFold 2-predicted 3D structure of nsp12 with selected mutations highlighted in stick representation in PyMOL. C , sequencing results of nsp12 expression plasmids carrying single point mutations. D , BHK-21 cells were co-transfected with sg-Rep-PRRSV, nsp12 mutants, and other mini-RTC components, and Fluc activity was measured at 36 hpt. Data are mean ± SD from at least three biological replicates. ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05; ns, not significant.

    Journal: The Journal of Biological Chemistry

    Article Title: Key amino acids in RNA polymerase and helicase proteins regulate RNA synthesis efficiency in porcine reproductive and respiratory syndrome virus

    doi: 10.1016/j.jbc.2025.110247

    Figure Lengend Snippet: Effect of nsp12 characteristic mutations on sg-Rep-PRRSV transcription efficiency. A , sequence alignment of nsp12 from PRRSV GD and XM-2020 strains, highlighting amino acid differences. B , AlphaFold 2-predicted 3D structure of nsp12 with selected mutations highlighted in stick representation in PyMOL. C , sequencing results of nsp12 expression plasmids carrying single point mutations. D , BHK-21 cells were co-transfected with sg-Rep-PRRSV, nsp12 mutants, and other mini-RTC components, and Fluc activity was measured at 36 hpt. Data are mean ± SD from at least three biological replicates. ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05; ns, not significant.

    Article Snippet: The primary antibodies used in this study were: rabbit anti-PRRSV-N polyclonal antibody (generated in our laboratory), rabbit anti-Fluc luciferase polyclonal antibody (BIOSS, bsm-33318M), mouse anti-β-Actin monoclonal antibody (Tianjin Sungene, DKM9001L), and mouse anti-GAPDH monoclonal antibody (Tianjin Sungene, DKM9002).

    Techniques: Sequencing, Expressing, Transfection, Activity Assay

    A , Experimental outline. WND238 melanoma cells were transduced with the MeRLin lentiviral barcode library containing semi-random barcodes (BC) embedded within EF1α-driven luciferase and mNeptune2.5 transcripts. Barcoded cells were expanded in vitro and injected subcutaneously into NSG mice to establish tumors. Tumor growth and dissemination were monitored for 4 to 12 weeks. Primary tumors and metastatic lesions, including those from lung and liver, were excised for downstream analyses, including single-cell RNA sequencing (scRNA-seq), bulk RNA sequencing (RNA-seq), and RNA fluorescence in situ hybridization (RNA-FISH). B , In vivo growth curves of barcoded WND238 tumors (n = 3). C , Bioluminescence imaging (BLI) of a mouse bearing a barcoded WND238 tumor 83 days post injection. Signals are detected at the primary site in dorsal (left) and ventral (middle) views. After shielding the primary tumor with a light proof cover, residual signals are detected in the lungs (right). D , Ex vivo BLI of the excised primary tumor (Tu) and organs including lung (Lu), liver (Lv), spleen (Sp), brain (Br), and heart (He), imaged with (left) and without (right) the primary tumor. E , Hematoxylin and eosin (H&E) staining of sections from the primary tumor (left), lung (middle), and liver (right) of the second mouse (scale bar 200 μm). F , Immunohistochemical (IHC) staining for firefly luciferase in sections from the primary tumor (left), lung (middle), and liver (right) of the second mouse (scale bar 200 μm). G , Pie chart showing the clonal composition of the original control (Table S3, bulk RNA-seq). H , Pie charts indicating the hierarchical clonal composition of the primary tumor, lung ( I ), and liver ( J ) (Table S3, scRNA-seq). K , Bubble plot showing the clonal frequency of 14 barcodes shared across all primary and metastatic sites in three biological replicates (ms 291, ms 292, and ms 287).

    Journal: bioRxiv

    Article Title: Single-cell lineage tracing maps clonal and transcriptional dynamics in melanoma metastasis

    doi: 10.64898/2026.04.09.717571

    Figure Lengend Snippet: A , Experimental outline. WND238 melanoma cells were transduced with the MeRLin lentiviral barcode library containing semi-random barcodes (BC) embedded within EF1α-driven luciferase and mNeptune2.5 transcripts. Barcoded cells were expanded in vitro and injected subcutaneously into NSG mice to establish tumors. Tumor growth and dissemination were monitored for 4 to 12 weeks. Primary tumors and metastatic lesions, including those from lung and liver, were excised for downstream analyses, including single-cell RNA sequencing (scRNA-seq), bulk RNA sequencing (RNA-seq), and RNA fluorescence in situ hybridization (RNA-FISH). B , In vivo growth curves of barcoded WND238 tumors (n = 3). C , Bioluminescence imaging (BLI) of a mouse bearing a barcoded WND238 tumor 83 days post injection. Signals are detected at the primary site in dorsal (left) and ventral (middle) views. After shielding the primary tumor with a light proof cover, residual signals are detected in the lungs (right). D , Ex vivo BLI of the excised primary tumor (Tu) and organs including lung (Lu), liver (Lv), spleen (Sp), brain (Br), and heart (He), imaged with (left) and without (right) the primary tumor. E , Hematoxylin and eosin (H&E) staining of sections from the primary tumor (left), lung (middle), and liver (right) of the second mouse (scale bar 200 μm). F , Immunohistochemical (IHC) staining for firefly luciferase in sections from the primary tumor (left), lung (middle), and liver (right) of the second mouse (scale bar 200 μm). G , Pie chart showing the clonal composition of the original control (Table S3, bulk RNA-seq). H , Pie charts indicating the hierarchical clonal composition of the primary tumor, lung ( I ), and liver ( J ) (Table S3, scRNA-seq). K , Bubble plot showing the clonal frequency of 14 barcodes shared across all primary and metastatic sites in three biological replicates (ms 291, ms 292, and ms 287).

    Article Snippet: Formalin-fixed, paraffin-embedded tissue sections (1-2 μm) were stained with an anti-firefly luciferase antibody (Novus Biologicals, NB100-1677).

    Techniques: Transduction, Luciferase, In Vitro, Injection, Single Cell, RNA Sequencing, Fluorescence, In Situ Hybridization, In Vivo, Imaging, Ex Vivo, Staining, Immunohistochemical staining, Immunohistochemistry, Control

    Comparison of the top performing WG‐PL14 LNPs with MC3 LNPs for intra‐articular injections. A) Representative biodistribution image of luciferase expression for original and optimized formulation LNP. B) The biodistribution image of luciferase expression in articular cartilage as measured with an IVIS imaging system 24 h after intra‐articular injection of 2 µg of total mRNA. C) Immunofluorescence staining for Luc in mouse chondrocytes after intra‐articular injection of LNP‐Luc mRNA (2 µg mRNA). The yellow arrows indicate the luminescent zone. D) Representative TEM and STEM of LNPs. E) The biodistribution image of luciferase expression in articular cartilage after intra‐articular injection of concentrated and unconcentrated LNP‐Luc mRNA (2 µg mRNA). F) The comparison between WG‐PL14 and MC3 in vivo expression, after injection of LNP‐Luc mRNA (2 µg mRNA), then imaged in 6, 24, 48, 72, and 96 h. Data were represented as mean ± SEM. Statistical significance was calculated by t ‐test. The unit of the fluorescent scale bar is photons/sec/cm 2 /sr, the F radiance scale of 1.0 × 10 7 –2 × 10 8 ( * p < 0.05, ** p < 0.01, and *** p < 0.001).

    Journal: Advanced Healthcare Materials

    Article Title: Targeted Therapy of Osteoarthritis via Intra‐Articular Delivery of Lipid‐Nanoparticle‐Encapsulated Recombinant Human FGF18 mRNA

    doi: 10.1002/adhm.202400804

    Figure Lengend Snippet: Comparison of the top performing WG‐PL14 LNPs with MC3 LNPs for intra‐articular injections. A) Representative biodistribution image of luciferase expression for original and optimized formulation LNP. B) The biodistribution image of luciferase expression in articular cartilage as measured with an IVIS imaging system 24 h after intra‐articular injection of 2 µg of total mRNA. C) Immunofluorescence staining for Luc in mouse chondrocytes after intra‐articular injection of LNP‐Luc mRNA (2 µg mRNA). The yellow arrows indicate the luminescent zone. D) Representative TEM and STEM of LNPs. E) The biodistribution image of luciferase expression in articular cartilage after intra‐articular injection of concentrated and unconcentrated LNP‐Luc mRNA (2 µg mRNA). F) The comparison between WG‐PL14 and MC3 in vivo expression, after injection of LNP‐Luc mRNA (2 µg mRNA), then imaged in 6, 24, 48, 72, and 96 h. Data were represented as mean ± SEM. Statistical significance was calculated by t ‐test. The unit of the fluorescent scale bar is photons/sec/cm 2 /sr, the F radiance scale of 1.0 × 10 7 –2 × 10 8 ( * p < 0.05, ** p < 0.01, and *** p < 0.001).

    Article Snippet: Immunohistochemistry staining was performed using antibodies against Collagen II (ab108349, Abcam; 1:200), Aggrecan (ab313636, Abcam; 1:2000), MMP13 (18165‐1‐AP, Protentech; 1:200), Collagen I (14695‐1‐AP, Proteintech; 1:500), IL‐1β (16806‐1‐AP, Proteintech; 1:200), Immunofluorescence was performed using antibody against firefly luciferase (Firefly luciferase, Santa Cruz Biotechnology, sc‐57603, 1:50).

    Techniques: Comparison, Luciferase, Expressing, Formulation, Imaging, Injection, Immunofluorescence, Staining, In Vivo